====== DNA Nanostructures ======

**2nd of September [[http://connectmedia.waag.org/AcadeMany/bio-2015/09/02/|videos]] ([[https://vimeo.com/138101701|review1 on vimeo]], [[https://vimeo.com/138102676|lesson2 on vimeo]]) - William Shih (Wyss Institute)**


=== PDF slides ===
  * [[https://www.dropbox.com/s/03vtx41lv2pab3i/150901_hgtaa_dna_nano_slides.pdf?dl=0]]

=== Reading assignment to prepare for lecture ===
  * [[http://www.nature.com/nnano/journal/v6/n12/full/nnano.2011.187.html]]
  * [[http://www.annualreviews.org/doi/abs/10.1146/annurev-biochem-060308-102244]]

=== Reading useful for the homework assignment ===
  * [[http://www.nature.com/nature/journal/v440/n7082/abs/nature04586.html]]
  * [[http://www.nature.com/nature/journal/v459/n7245/full/nature08016.html]]
  * [[http://www.sciencemag.org/content/325/5941/725]]
  * [[http://nar.oxfordjournals.org/content/37/15/5001]]

=== Software needed for the homework assignment ===
  * [[http://cadnano.org/legacy]]
caDNAno and linux users:
  * [[https://github.com/cadnano/cadnano2.5]]

=== caDNAno software tutorials useful for the homework assignment ====
  * [[https://www.youtube.com/watch?v=cwj-4Wj6PMc&feature=youtu.be]]
  * [[https://www.youtube.com/watch?v=EabqNaYAI7o&feature=youtu.be]]

=== Homework assignment ===
  * Build flattened Rothemund rectangle in caDNAno (output: json file)
    * {{:150830_flat_rectangle.pdf|}}
  * Generate staple strand sequences in caDNAno (output: list of sequences in tab delimited text file)
  * Color staple strands to create a black-and-white pattern in caDNAno (output: json file)
  * Generate ASCII file black-and-white image (output: text file)
    * [[https://www.dropbox.com/s/xipzv7mumokihzh/150830_rectangle_pattern.txt?dl=0]]
  * Generate list of wells to pipet to generate black-and-white pattern (output: list of wells)
    * [[https://www.dropbox.com/s/8wce2okbz08pg05/150830_empty_pipetting_rectangle.txt?dl=0]]
      * These are the pixels with value 0
    * [[https://www.dropbox.com/s/39lo2caftolprp6/150830_dumbbell_pipetting_rectangle.txt?dl=0]]
      * These are the pixels with value 1

=== Extra-credit homework assignment ===
  * [[https://www.dropbox.com/s/a8872vj86r2oqox/150830_extra_credit_files.zip?dl=0]]
  * Generate caDNAno-format json file encoding 24 strand flat rectangle from a Python script
  * Write a Python script that outputs the sequences in 96-well format according to pattern described by
    * [[https://www.dropbox.com/s/8wce2okbz08pg05/150830_empty_pipetting_rectangle.txt?dl=0]]
    * These are the pixels with value 0
  * Write a Python script that outputs the sequences with dumbbell insertion 'TCCTCTTTTGAGGAACAAGTTTTCTTGT' exactly in the middle of each strand in 96-well format according to
    * [[https://www.dropbox.com/s/8wce2okbz08pg05/150830_empty_pipetting_rectangle.txt?dl=0]]
    * These are the pixels with value 1
  * Ideally at least two teams achieve this goal, so you can cross-validate your results against each other to gain confidence that the design is correct

=== Extra-extra credit homework assignment ===
  * Pool resources to order collectively from IDT the four 96-well plates needed to render 1-bit patterns
    * ~$1500–$2000 for this set of strands on the 10 nmol scale (request 6 nmol total: 60 µL at 100 µM in water)
    * Assuming each pattern will consume 10 pmol per strand, this will be enough material to fold 600 patterns
    * If anybody makes it this far in the assignment, I (i.e. William Shih) will proofread your order and assist with formatting your order to IDT, give you more detailed protocols for folding and gel analysis (although you can find this all in the primary literature assigned as reading for this class)
  * Pipet strands (10 pmol each) to generate all patterns submitted by teams in the class
  * Fold patterns in a thermocycler in a volume of 100 µL per pattern
  * Check to see that the structures fold correctly by agarose-gel analysis of 15 µL aliquot
  * Find a partner (commercial or otherwise) willing to do AFM imaging of your samples
  * Submit your samples to that partner (only 1 µL required for imaging)